Skip to main content
Download PDF
Download ePub

Increased matrix metalloproteinase-1 expression by coexposure to UVA and cigarette sidestream smoke and contribution of histone acetylation

Genes and Environment volume 47, Article number: 2 (2025) Cite this article

Abstract

Background

Skin is exposed to various environmental factors throughout life, and some of these factors are known to contribute to skin aging. Long-term solar UV exposure is a well-known cause of skin aging, as is cigarette smoke, which contains a number of chemicals. In this study, combined effect of UVA and cigarette sidestream smoke (CSS) on matrix metalloproteinase-1 (MMP-1) induction was investigated. MMP-1 is the main protease that initiates collagen type I fiber fragmentation in human skin and is associated with aging.

Results

Combined exposure to UVA and CSS enhanced MMP-1 induction, accompanied by collagen type I (COL1A1) gene suppression. The basal expression of MMP-1 was higher in senescent cells than in normal cells, with a pronounced increase after coexposure to UVA and CSS. UVA irradiation resulted in global histone H3 acetylation, and we considered this was responsible for the MMP-1 upregulation. Histone deacetylase inhibitors, sodium acetate, propionate, and butyrate, all enhanced the CSS-induced MMP-1 according to the degree of histone acetylation.

Conclusion

These results suggest that UVA and CSS additively induce MMP-1, which may lead to skin aging, and that such combined effect may further promote aging in aged skin. UVA-induced histone acetylation may contribute to MMP-1 induction.

Introduction

The skin is a primary organ that interacts with the environment. It is regularly exposed to various environmental stressors such as solar light and environmental chemicals. Among them, long-term solar UV radiation (UVR) causes photoaging and skin cancer. Photoaging is characterized by skin wrinkling and laxity, largely due to the alteration of dermal connective tissue, including type I collagen fibrils [1]. Matrix-degrading proteolytic enzymes (matrix metalloproteinases, MMPs) degrade the collagen and UVR has been reported to induce MMPs such as MMP-1, -3 and − 9 [2,3,4,5].

Solar UVR wavelength is divided into UVA (315–400 nm), UVB (280–315 nm), and UVC (100–280 nm) [6]. The UV component of terrestrial radiation from the midday sun is approximately 95% UVA and 5% UVB. Stratospheric ozone removes the UVC and part of the UVB (< 290 nm) wavelengths from terrestrial radiation. Both UVA and UVB are known to induce the MMPs [4, 7, 8]. Tewari et al. [9] showed that solar UVB exposure is likely the main cause of photoaging by MMP-1 expression. However, it is generally accepted that UVA influences photoaging more than UVB. UVA radiation is 10 to 100 times more abundant in natural sunlight and penetrates deeper into the dermis than UVB radiation [10]. Dermal fibroblasts are well known to express MMP-1 after UVA irradiation [7, 8]. Furthermore, UVA1, long wavelength (340–400 nm) and comprising 75% of UVA, induced dermal MMPs more than UVB [11]. The greater contribution from different spectrum of UVR, UVA or UVB, may depend on the time point after exposure and the depth of the skin, i.e., epidermis or dermis [5, 11].

Environmental stresses other than UVR also accelerate skin aging by MMPs upregulation [12]. Among these, smoking is a well-known factor for wrinkling and premature skin aging [13]. Smoking increases the number of elastic fibers due to the degradation of elastic materials, as it occurs similarly in solar elastosis [14]. Cigarette smoke extract induces MMPs and degrades procollagens in fibroblasts obtained from non-smoking healthy individuals [15, 16], similar to UVR as noted above. An in vivo study also showed that topical or intracutaneous treatment with cigarette smoke extract decreased type I collagen in mouse skin [17]. Interestingly, cigarette smoke and UVA additively induced MMP-1 expression [18], suggesting that several environmental chemicals and UVR may interact and accelerate skin aging. However, the detailed mechanism of the increased MMP-1 induction after coexposure to cigarette smoke and UVA is unclear.

MMP genes such as MMP13, MMP12, MMP3, and MMP1 are clustered at chromosome 11q22.3. UVB irradiation increases the activity of transcription for most MMP genes. This heightened transcription occurs at specific regions called promoters, where histone H3 acetylation has taken place [19]. Histone acetylation is critical in the regulation of DNA transcription and damage repair, and the degree of acetylation is mediated by histone acetyltransferase (HAT) and histone deacetylase (HDAC) [20, 21]. Global hyperacetylation with increased p300 HAT and decreased HDAC1 and sirtuin1 was observed in chronically sun-exposed skin compared to sun-protected area [22]. Histone acetylation caused by p300 HAT after UVR, promoted MMP-1 gene transcription in dermal fibroblasts [23, 24].

In this study, the combined effect of UVA and cigarette sidestream smoke (CSS) on MMP-1 induction was investigated. UVA and CSS induced MMP-1 independently, and they were additive. Basal MMP-1 expression was high in senescent cells and further promoted by the combined treatment. The induction mechanism was further investigated using HDAC inhibitors. UVA-induced histone acetylation, and hyperacetylation by HDAC inhibitors remarkably enhanced CSS-induced MMP-1. These data provide insight into the importance of histone acetylation in skin aging accelerated by environmental stressor.

Materials and methods

Cell culture

Human dermal fibroblasts, ASF-4-1, were obtained from the Japanese Collection of Research Bioresources (JCRB) Cell Bank (Osaka, Japan). ASF-4-1 [JCRB population doubling level (PDL) = 34] was established from skin of the donor at 36 years and 2 months of age [25]. Eagle’s minimal essential medium (EMEM) with 10% fetal bovine serum (FBS, Biosera, UK) was used as the culture medium, and subculturing was performed at a split ratio of 1:4 every week.

Cellular life span was determined based on PDL. To determine PDL, ΔPDL at each passage was obtained from the equation using the number of seeded cells at a passage and the number of collected cells at the next passage. ΔPDL = log10(total cells/plated cells) / log10 2.

Preparation of CSS

Cigarette smoke generated by the natural combustion of five cigarettes was collected in 100 mL of EMEM by bubbling using a dry vacuum pump as described in our previous paper [26]. This EMEM containing smoke extract is herein referred to as ‘CSS (100%)’.

Combined exposure to UVA and CSS

Immediately before UVA irradiation, the medium was changed to PBS containing calcium and magnesium. A medium change was also performed for non-irradiated cells. ASF-4-1 cells were exposed to UVA, followed by incubation with or without CSS for 24 h. The wavelength characteristic of the UVA lamp (FL20S-BL-B, HITACHI), reconstructed from manufacturing data, is shown in the Supplementary Materials (Supplementary Fig. S1). Approximately 0.5 cm-thick glass plate was mounted 3 cm above the cell culture dishes to remove UVC and shorter UVB wavelengths from UVA radiation as much as possible. Irradiance was measured using a radiometer (Atto Co., Ltd., Tokyo, Japan) with 365 nm detector (Atto Co., Ltd., Tokyo, Japan). The irradiance was 70 kJ/m2/h.

Reverse transcription-quantitative PCR (RT-qPCR)

Cells coexposed to UVA and CSS were harvested and RNA was extracted with NucleoSpin RNA kit (Takara Bio, Shiga, Japan) according to manufacturer’s protocol. RNA concentrations were determined by Nano Drop 2000 (Thermo Fisher Scientific, Waltham, MA) and the 2 ng (/10 µL) of RNA was reverse transcribed to cDNA using PrimeScript™ RT reagent kit (Takara Bio). Each PCR was carried out in quadruplicate in a 10 µL volume using SYBR™ Green Master Mix (Thermo Fisher Scientific) for 1 min at 95°C for initial denaturing, followed by 40 cycles of 95°C for 15 sec, 60°C for 15 sec and 72°C for 1 min in the Step One 2.3 Real-Time PCR Cycler (Thermo Fisher Scientific). The sequences of the primers used for qPCR are as follows; MMP-1: f-5’GGGAGATCATCGGGACAACTC3’, r-5’TGAGCATCCCCTCCAATACC3’, COL1A1: f-5’GATTCCCTGGACCTAAAGGTGC3’, r-5’AGCCTCTCCATCTTTGCCAGCA3’, GAPDH: f-5’GAGTCAACGATTTGGTCGT3’, r-5’TTGATTTTGGAGGGATCTCG3’. The quantification cycle (CQ) values were used for relative quantitation of samples. Values for each gene were normalized to GAPDH expression levels and expressed as fold increase over untreated control.

Western blotting

The treated cells were scraped, pelleted, suspended in lysis buffer (100 mM Tris-HCl (pH 8.0), 50 mM EDTA, 0.5% Triton X-100) containing protease inhibitors (Wako #161-26023), sonicated for 30 s, mixed with an equal volume of 2x sample buffer (0.1 M Tris-HCl (pH6.8), 4% SDS, 20% glycerol, 12% 2-mercaptoethanol, 0.004% bromophenol blue), and boiled for 5 min.

Proteins were separated by 10 or 15% polyacrylamide gels and transferred to polyvinylidene fluoride membranes. After blocking with 0.2% skim milk or albumin, membranes were incubated with primary antibodies against global N-terminal acetyl-histone H3 (#06-599), acetyl-histone H3 (Lys 9) (#06-942), acetyl-histone H3 (Lys 14) (#06-911) (Merck Millipore, Burlington, MA), MMP-1 (GTX100534) (GeneTex, Alton Pkwy Irvine, CA), and actin (sc-1615) (Santa Cruz Biotechnology, Dallas, TX) overnight at 4℃, then incubated with secondary antibody conjugated with horseradish peroxidase (Jackson ImmunoResearch Laboratories, West Grove, PA) for 2 h. Protein expression was visualized with an enhanced chemiluminescence plus detection kit (Thermo Fisher Scientific, Waltham, MA).

Cell survival assay

Treated cells were harvested using trypsin-EDTA solution and then suspended in EMEM. Trypan blue solution (0.3%) was added to the cell suspension (1:1) for the discrimination of dead cells. More than 400 cells per sample were counted under the microscope.

Statistical analysis

All experiments were repeated two to three times. Data are presented as the mean ± S.D. Data were analyzed by Student’s t-test for comparisons between groups.

Results

MMP-1 expression after exposure to UVA or CSS

The ASF-4-1 cell line, established from donor skin at 36 years and 2 months of age [25], has a finite lifespan and was used between PDL35-47. UVA exposure significantly induced MMP-1 mRNA (Fig. 1A). Treatment with CSS above 2% also promoted MMP1 mRNA. As CSS above 5% showed drastic cell death (data not shown), we mainly used CSS below 4% in this study. Protein levels yielded similar results, i.e., MMP-1 was induced in a UVA- and CSS-dose-dependent manner (Fig. 1B). Since 5% of CSS caused 100% of cell death after treatment for 24 h, the decrease of MMP-1 was probably due to cytotoxicity. COL1A1 encodes the major component of type I collagen that can be degraded by MMP-1. COL1A1 mRNA was significantly downregulated by both UVA and CSS (Fig. 1C). These results were consistent with the previous reports on MMP-1 induction [7, 8, 15] and collagen reduction [15,16,17] after treatment with UVA or cigarette mainstream smoke, while this study used CSS.

Fig. 1
figure 1

MMP-1 induction after exposure to UVA or CSS. (A) (C) MMP-1 and COL1A1 mRNA expression 24 h after exposure to UVA or CSS. ASF-4-1 cells were irradiated with UVA (15 or 30 kJ/m2) or treated with CSS (2 or 3%). After incubation for 24 h, RT-qPCR was performed as described in Materials and Methods. (B) Protein levels of MMP-1 24 h after exposure to UVA or CSS. ASF-4-1 cells were irradiated with UVA (up to 60 kJ/m2) or treated with CSS (up to 5%). After incubation for 24 h, cells were lysed and Western blotting was performed as described in Materials and Methods. Actin was used as a standard for the equal loading of proteins for SDS–PAGE. *p < 0.05. ***p < 0.001 (vs. untreated (UVA 0 kJ/m2 or CSS 0%))

Full size image

Combined exposure enhanced MMP-1 expression

Combined exposure to UVA and CSS synergistically enhanced cell death (Fig. 2A). Treatment with CSS up to 4% for 24 h showed approximately 20 to 30% cell death, which increased to 70 to 80% with UVA pre-irradiation. Similarly, the slight cell death after UVA irradiation was significantly enhanced after CSS treatment.

Fig. 2
figure 2

Cell survival and MMP-1 induction after combined exposure to UVA and CSS. (A) Survival after coexposure to UVA and CSS. ASF-4-1 cells were irradiated with UVA (up to 60 kJ/m2), followed by treatment with CSS (up to 4%). After incubation for 24 h, cell survival was determined using trypan blue assay as described in Materials and Methods. ***p < 0.001 (vs. UVA 0 kJ/m2), ###p < 0.001 (vs. CSS 0%). (B) MMP-1 and COL1A1 mRNA expression 24 h after combined exposure to UVA and CSS. ASF-4-1 cells were irradiated with UVA (15 kJ/m2), followed by treatment with CSS (2%). After incubation for 24 h, RT-qPCR was performed. *p < 0.05, **p < 0.01, ***p < 0.001 (vs. untreated). (C) MMP-1 protein levels 24 h after combined exposure to UVA and CSS. ASF-4-1 cells were irradiated with UVA (15 or 30 kJ/m2), followed by treatment with CSS (up to 4%). After incubation for 24 h, cells were lysed and Western blotting was performed. Actin was used as a standard for the equal loading of proteins for SDS–PAGE

Full size image

Both MMP-1 and COL1A1 mRNA were additively altered after combined treatments with UVA and CSS (Fig. 2B). Such additive effect of UVA and CSS on COL1A1 mRNA suppression has not been reported elsewhere. MMP-1 protein levels were also altered, with CSS-dependent MMP-1 increase significantly enhanced by UVA pre-irradiation (Fig. 2C and Supplementary Fig. S2).

Cell senescence promoted MMP-1 expression after combined exposure

The ASF-4-1 cell line is a model system for cellular aging [27]. In this study, the cell passage was repeated and the high PDL cells (PDL56 or 58) were established. From PDL55, remarkably elevated cellular senescence markers for β-galactosidase activity and decreased cell proliferation were marked [28]. The senescent cells (PDL 56) yielded approximately 20 times higher basal MMP-1 expression than normal cells (PDL 42) (Fig. 3A). Combined exposure to UVA and CSS further augmented the MMP-1 expression enhanced by cellular senescence. As COL1A1 mRNA expression in PDL56 cells reduced to 20% of normal cells, the further reduction by combined exposure looks small but was significant. The MMP-1 protein levels were also in proportion to the induction of the mRNA, and UVA-, CSS- and coexposure-induced MMP-1 were promoted in senescent cells (Fig. 3B and Supplementary Fig. S3).

Fig. 3
figure 3

MMP-1 induction in senescent cells after combined exposure to UVA and CSS. ASF-4-1 cells were passaged 1:4 once per week, increasing PDL by 2. Cells above PDL55 exhibit aging phenotype. (A) MMP-1 and COL1A1 mRNA expression 24 h after combined exposure to UVA and CSS. ASF-4-1 cells with PDL42 (normal cells) and 56 (senescent cells) were irradiated with UVA (15 kJ/m2), followed by treatment with CSS (2%). After incubation for 24 h, RT-qPCR was performed. *p < 0.05, **, ##p < 0.01, ***, ###p < 0.001 (vs. untreated). (B) Protein levels of MMP-1 24 h after combined exposure to UVA and CSS. ASF-4-1 cells (PDL42 and PDL58) were irradiated with UVA (15 kJ/m2), followed by treatment with CSS (2%). After incubation for 24 h, cells were lysed and Western blotting was performed. Actin was used as a standard for the equal loading of proteins for SDS–PAGE

Full size image

Histone acetylation augmented MMP-1 expression

UVR is reported to acetylate histone via the histone acetyltransferase activation, leading to MMP-1 expression [23, 24]. UVA exposure promoted global histone H3 acetylation in a dose dependent manner (Fig. 4A). To further clarify the relationships between histone acetylation and CSS-amplified MMP-1, sodium butyrate (SB), a representative HDAC inhibitor, was dosed instead of UVA exposure, followed by CSS treatment. The MMP-1 mRNA was remarkably induced by SB, which was further enhanced by CSS (Fig. 4B). The relative decrease was found in COL1A1. Figure 4C shows the protein levels after combined treatment with SB and CSS. SB clearly acetylated histone H3 dose-dependently. MMP-1 expression was similar or slightly increased at 24 h in the presence of SB only and enhanced by combined treatment with CSS.

Fig. 4
figure 4

Histone acetylation by UVA or SB, and MMP-1 induction after treatment with CSS. (A) Histone acetylation after UVA irradiation. ASF-4-1 cells were irradiated with UVA (up to 15 kJ/m2) and cultured for 8–24 h. Western blotting was performed and histone acetylation was analyzed using three types of histone acetylation antibodies. Actin was used as a standard for the equal loading of proteins for SDS–PAGE. (B) MMP-1 and COL1A1 mRNA expression 24 h after combined exposure to SB and CSS. ASF-4-1 cells were treated with SB (3 mM), followed by treatment with CSS (2%). After incubation for 24 h, RT-qPCR was performed. *p < 0.05, **p < 0.01, ***p < 0.001 (vs. SB 0 mM). (C) Protein levels of global histone acetylation and MMP-1 24 h after combined exposure to SB and CSS. ASF-4-1 cells were treated with SB (up to 10 mM) for 24 h, followed by treatment with CSS (up to 4%). After incubation for 24 h, cells were lysed and western blotting was performed

Full size image

The degree of histone acetylation influenced CSS-induced MMP-1 expression. Other members of short chain fatty acids (SCFAs), sodium acetate (SA) and sodium propionate (SP) were compared with SB (Fig. 5 and Supplementary Fig. S4). Histone acetylation increased in the order of SCFA chain lengths, SA < SP < SB. The MMP-1 induction was proportional to the acetylation level. SA, with the lowest acetylation, only slightly increased MMP-1 after combined exposure, whereas SB, with the strongest effect, showed a very pronounced induction.

Fig. 5
figure 5

Histone acetylation by SCFAs and MMP-1 induction after treatment with CSS. (A) Structure of SCFAs. (B) MMP-1 induction and acetylation of histone H3 24 h after combined exposure to SCFAs and CSS. ASF-4-1 cells were treated with SCFAs (up to 10 mM), followed by treatment with CSS (2%). After incubation for 24 h, Western blotting was performed. Actin was used as a standard for the equal loading of proteins for SDS–PAGE

Full size image

Discussion

Collagen fibrils are largely responsible for skin strength and resilience, and the degradation and the alteration in structure link to skin aging including skin wrinkling and laxity [1]. Type I collagen is the major dermal extracellular matrix structural protein, and its precursor molecule, procollagen, is synthesized by dermal fibroblasts [29]. UVR is a typical cause for skin aging, and is known to alter dermal collagen by two pathways, collagen degradation and inhibition of procollagen biosynthesis. This study showed that UVA irradiation activated both pathways via MMP-1 induction and COL1A1 suppression, which was similarly observed in CSS treatment and exacerbated by combined treatment.

Cellular oxidation is a major contributing factor to MMP-1 induction [12]. Reactive oxygen species (ROS) including singlet oxygen produced after UVA exposure elevate MMP-1 [30]. We previously showed that CSS also increases intracellular ROS [26]. CSS-induced lipid peroxidation and subsequent production of 4-hydroxynonenal is also reported to generate ROS [31]. ROS activate the mitogen-activated protein kinase (MAPK) family, composed of extracellular signal-regulated kinase (ERK), c-Jun NH2-terminal kinase (JNK) and p38. This family is crucial for activating c-Fos and c-Jun, which combine to form the transcriptional factor AP-1, essential in MMPs transcription. In our preliminary experiments, the specific inhibitors for MAPKs, U0126 for ERK and SP600125 for JNK, effectively suppressed the expression of MMP-1 after coexposure to UVA and CSS (data not shown), suggesting that both UVA and CSS activate MAPKs, leading to MMP induction. Furthermore, AP-1 is known to inhibit transforming growth factor-β (TGF-β), an important regulator of procollagen type I production. UVR downregulated TGF-β receptor signaling [32] and UVA reduced TGF-β-induced production of collagen [33]. In addition, TGF-β inhibited CSS-induced MMP-1 mRNA [34]. TGF-β signaling may be involved in our finding of an enhanced decrease in COL1A1 after co-exposure to UVA and CSS. These complicated pathways arising from ROS would alter the collagen conditions related to skin aging. On the other hand, there are reports supporting that UVB-induced DNA damage triggers the induction of MMPs [35, 36]. MMP-1 induction after UVB irradiation was reduced by treatment with DNA damage repair enzyme [35]. DNA damage activates ATM, which subsequently activates JNK and p38, leading to SP1 binding to the promoter regions of MMP-2 and MMP-11 to promote their transcription [36]. Although we tried to eliminate the UVC and UVB components from the UVA irradiation using a glass plate but it is possible there was a slight contribution from UVB. Additionally, although UVA and CSS both generate DNA damage, 8-oxo-deoxyguanosine and DNA double strand break, respectively [26, 37], whether these DNA damages other than UVB-induced pyrimidine dimers can induce MMPs, are not well examined.

Histone acetylation in promoter region at the MMP gene cluster is required for transcriptional activation of genes on this cluster [19]. UVR-induced histone acetylation at the promoter regions of the MMP-1 gene by p300 HAT binding [23, 24] may be a cause of MMP-1 expression after coexposure to UVA and CSS. We found that UVA acetylated histone H3, whereas CSS did not (data not shown), presumably because the aldehydes in CSS readily react with histone lysine residues and partly block the acetylation reaction. However, it is possible that chemicals other than aldehydes contained in CSS acetylate histones, as we have previously demonstrated [38], and further accelerate the induction of MMP-1 with UVA. Treatment with HDAC inhibitors instead of UVR resulted in global histone acetylation and augmented MMP genes [19]. The degree of histone acetylation by three kinds of SCFAs was relative to the amount of CSS-induced MMP-1 (Fig. 5), suggesting the important role of histone acetylation in additive UVA and CSS effects. Furthermore, SCFAs synergistically enhanced ligand-induced expression of aryl hydrocarbon receptor (AhR)-responsive genes [39]. CSS contains numerous components including polycyclic aromatic hydrocarbons which trigger AhR signaling pathways. AhR knockdown and inhibition studies suggested that AhR pathways are required for CSS-induced MMP-1 induction [40]. UVA-induced histone acetylation may promote the CSS-induced AhR pathway, resulting in MMP-1 expression.

MMP-1, an important player for skin aging, was expressed at higher levels in senescent cells than in normal cells, with coexposure to UVA and CSS further enhancing the expression (Fig. 3). Although we used replicatively senescent fibroblasts, the increased MMP-1 level was similarly confirmed in aged (> 80 years old) human skin in vivo, where c-Jun expression and ROS generation were also detected [41]. In aged mouse skin, environmental stressors including UV and CSS sensitively expressed MMPs [42], consistent with our in vitro experiment using replicatively senesced fibroblasts. UVR-increased histone acetylation and decreased HDAC expression were observed in aged human skin, suggesting that histone acetylation by UVR has an important role in MMP-1 expression [43]. However, in general, global histone acetylation might be low in cultured senescent cells as cell division and related gene expressions are infinitely suppressed. We need further investigation into whether histone modification at MMP promoter regions differs between normal and senescent cells.

Conclusion

UVA pre-irradiation promoted CSS-induced MMP-1 expression, which was remarkable in senescent cells. UVA-induced histone acetylation may lead to a combined effect on MMP-1 induction. The skin is exposed to a number of environmental stressors on a daily basis and some of them are associated with skin aging [12, 44]. Histone acetylation could be an important factor in accelerating aging in terms of MMPs expression after combined exposure to UV and various environmental chemicals.

Data availability

No datasets were generated or analysed during the current study.

Abbreviations

CSS:

Cigarette sidestream smoke

COL1A1:

Collagen type I

EMEM:

Eagle’s minimal essential medium

FBS:

Fetal bovine serum

HAT:

Histone acetyltransferase

HDAC:

Histone deacetylase

MMPs:

Matrix metalloproteinases

PDL:

Population doubling level

SA:

Sodium acetate

SB:

Sodium butyrate

SCFAs:

Short chain fatty acids

SP:

Sodium propionate

UVR:

UV radiation

References

  1. Fisher GJ, Varani J, Voorhees JJ. Looking older: fibroblast collapse and therapeutic implications. Arch Dermatol. 2008;144(5):666–72.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Fisher GJ, et al. Molecular basis of sun-induced premature skin ageing and retinoid antagonism. Nature. 1996;379(6563):335–9.

    Article  CAS  PubMed  Google Scholar 

  3. Fisher GJ, et al. Pathophysiology of premature skin aging induced by ultraviolet light. N Engl J Med. 1997;337(20):1419–28.

    Article  CAS  PubMed  Google Scholar 

  4. Brenneisen P, Sies H, Scharffetter-Kochanek K. Ultraviolet-B irradiation and matrix metalloproteinases: from induction via signaling to initial events. Ann N Y Acad Sci. 2002;973:31–43.

    Article  CAS  PubMed  Google Scholar 

  5. Quan T, et al. Matrix-degrading metalloproteinases in photoaging. J Investig Dermatol Symp Proc. 2009;14(1):20–4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Radiation. Lyon (FR): International Agency for Research on Cancer; 2012. (IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, No. 100D.) Solar and ultraviolet radiation. https://www.ncbi.nlm.nih.gov/books/NBK304366/

  7. Scharffetter K, et al. UVA irradiation induces collagenase in human dermal fibroblasts in vitro and in vivo. Arch Dermatol Res. 1991;283(8):506–11.

    Article  CAS  PubMed  Google Scholar 

  8. Herrmann G, et al. UVA irradiation stimulates the synthesis of various matrix-metalloproteinases (MMPs) in cultured human fibroblasts. Exp Dermatol. 1993;2(2):92–7.

    Article  CAS  PubMed  Google Scholar 

  9. Tewari A, et al. Human erythema and matrix metalloproteinase-1 mRNA induction, in vivo, share an action spectrum which suggests common chromophores. Photochem Photobiol Sci. 2012;11(1):216–23.

    Article  CAS  PubMed  Google Scholar 

  10. Tewari A, et al. UVA1 is skin deep: molecular and clinical implications. Photochem Photobiol Sci. 2013;12(1):95–103.

    Article  CAS  PubMed  Google Scholar 

  11. Tewari A, et al. Upregulation of MMP12 and its activity by UVA1 in human skin: potential implications for photoaging. J Invest Dermatol. 2014;134(10):2598–609.

    Article  CAS  PubMed  Google Scholar 

  12. Fussell JC, Kelly FJ. Oxidative contribution of air pollution to extrinsic skin ageing. Free Radic Biol Med. 2020;151:111–22.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Lipa K, et al. Does smoking affect your skin? Postepy Dermatol Alergol. 2021;38(3):371–6.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Just M, et al. Effect of smoking on skin elastic fibres: morphometric and immunohistochemical analysis. Br J Dermatol. 2007;156(1):85–91.

    Article  CAS  PubMed  Google Scholar 

  15. Yin L, Morita A, Tsuji T. Alterations of extracellular matrix induced by tobacco smoke extract. Arch Dermatol Res. 2000;292(4):188–94.

    Article  CAS  PubMed  Google Scholar 

  16. Gugatschka M, et al. Proteomic analysis of Vocal fold fibroblasts exposed to cigarette smoke extract: exploring the pathophysiology of Reinke’s Edema. Mol Cell Proteom. 2019;18(8):1511–25.

    Article  CAS  Google Scholar 

  17. Tanaka H, et al. Tobacco smoke extract induces premature skin aging in mouse. J Dermatol Sci. 2007;46(1):69–71.

    Article  CAS  PubMed  Google Scholar 

  18. Yin L, Morita A, Tsuji T. Skin aging induced by ultraviolet exposure and tobacco smoking: evidence from epidemiological and molecular studies. Photodermatol Photoimmunol Photomed. 2001;17(4):178–83.

    Article  CAS  PubMed  Google Scholar 

  19. Ujfaludi Z, et al. Coordinated activation of a cluster of MMP genes in response to UVB radiation. Sci Rep. 2018;8(1):2660.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Kuo M-H, Allis CD. Roles of histone acetyltransferases and deacetylases in gene regulation. BioEssays. 1998;20(8):615–26.

    Article  CAS  PubMed  Google Scholar 

  21. Gong F, Miller KM. Mammalian DNA repair: HATs and HDACs make their mark through histone acetylation. Mutat Res. 2013;750(1–2):23–30.

    Article  CAS  PubMed  Google Scholar 

  22. Ding S, et al. Chronic sun exposure is associated with distinct histone acetylation changes in human skin. Br J Dermatol. 2018;179(1):110–7.

    Article  CAS  PubMed  Google Scholar 

  23. Kim MK, et al. The role of p300 histone acetyltransferase in UV-induced histone modifications and MMP-1 gene transcription. PLoS ONE. 2009;4(3):e4864.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Kim MK, et al. UV-induced DNA damage and histone modification may involve MMP-1 gene transcription in human skin in vivo. J Dermatol Sci. 2014;73(2):169–71.

    Article  CAS  PubMed  Google Scholar 

  25. Naru E, et al. Increased levels of a particular phosphatidylcholine species in senescent human dermal fibroblasts in vitro. Hum Cell. 2008;21(3):70–8.

    Article  PubMed  Google Scholar 

  26. Toyooka T, Ibuki Y. Cigarette sidestream smoke induces phosphorylated histone H2AX. Mutat Res. 2009;676(1–2):34–40.

    Article  CAS  PubMed  Google Scholar 

  27. Kaji K, et al. Donor age reflects the replicative lifespan of human fibroblasts in culture. Hum Cell. 2009;22(2):38–42.

    Article  PubMed  Google Scholar 

  28. Suzuki T, et al. Faulty gap filling in nucleotide excision repair leads to double-strand break formation in senescent cells. J Invest Dermatol. 2025;145(1):32–e4111.

    Article  CAS  PubMed  Google Scholar 

  29. Nimni ME. Collagen: structure, function, and metabolism in normal and fibrotic tissues. Semin Arthritis Rheum. 1983;13(1):1–86.

    Article  CAS  PubMed  Google Scholar 

  30. Scharffetter-Kochanek K, et al. Singlet oxygen induces collagenase expression in human skin fibroblasts. FEBS Lett. 1993;331(3):304–6.

    Article  CAS  PubMed  Google Scholar 

  31. Pecorelli A, et al. Involvement of 4-hydroxy-2-nonenal in pollution-induced skin damage. BioFactors. 2019;45(4):536–47.

    Article  CAS  PubMed  Google Scholar 

  32. Quan T, et al. Solar ultraviolet irradiation reduces collagen in photoaged human skin by blocking transforming growth factor-β type II receptor/Smad signaling. Am J Pathol. 2004;165(3):741–51.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Hsiao YT, et al. Ultraviolet A at levels experienced outdoors suppresses transforming growth factor-beta signaling and collagen production in human scleral fibroblasts. Biochem Biophys Res Commun. 2023;641:10–7.

    Article  CAS  PubMed  Google Scholar 

  34. Yin L, Morita A, Tsuji T. Tobacco smoke extract induces age-related changes due to modulation of TGF-β. Exp Dermatol. 2003;12(Suppl 2):51–6.

    Article  PubMed  Google Scholar 

  35. Dong KK, et al. UV-induced DNA damage initiates release of MMP-1 in human skin. Exp Dermatol. 2008;17(12):1037–44.

    Article  CAS  PubMed  Google Scholar 

  36. Kim DJ et al. UVB-mediated DNA damage induces matrix metalloproteinases to promote photoaging in an AhR- and SP1-dependent manner. JCI Insight, 2022. 7(9).

  37. Toyooka T, et al. Coexposure to benzo[a]pyrene and UVA induces DNA damage: first proof of double-strand breaks in a cell-free system. Environ Mol Mutagen. 2006;47(1):38–47.

    Article  CAS  PubMed  Google Scholar 

  38. Shikata M, et al. 4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone-Induced Histone Acetylation via α7nAChR-Mediated PI3K/Akt Activation and Its Impact on γ-H2AX Generation. Chem Res Toxicol. 2021;34(12):2512–21.

    Article  CAS  PubMed  Google Scholar 

  39. Jin UH, et al. Short chain fatty acids enhance aryl hydrocarbon (Ah) responsiveness in mouse colonocytes and Caco-2 human Colon cancer cells. Sci Rep. 2017;7(1):10163.

    Article  PubMed  PubMed Central  Google Scholar 

  40. Ono Y, et al. Role of the aryl hydrocarbon receptor in tobacco smoke extract-induced matrix metalloproteinase-1 expression. Exp Dermatol. 2013;22(5):349–53.

    Article  CAS  PubMed  Google Scholar 

  41. Fisher GJ, et al. Collagen fragmentation promotes oxidative stress and elevates matrix metalloproteinase-1 in fibroblasts in aged human skin. Am J Pathol. 2009;174(1):101–14.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Fortino V, et al. Cutaneous MMPs are differently modulated by environmental stressors in old and young mice. Toxicol Lett. 2007;173(2):73–9.

    Article  CAS  PubMed  Google Scholar 

  43. Lee Y et al. Increased histone acetylation and decreased expression of specific histone deacetylases in ultraviolet-irradiated and intrinsically aged human skin in vivo. Int J Mol Sci, 2021. 22(4).

  44. Schikowski T, Huls A. Air pollution and skin aging. Curr Environ Health Rep. 2020;7(1):58–64.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work has been supported in part by JSPS KAKENHI Grant No. 23K09650 and the Smoking Research Foundation.

Author information

Authors and Affiliations

  1. Graduate Division of Nutritional and Environmental Sciences, University of Shizuoka, Yada 52- 1, Suruga-ku, Shizuoka, 422-8526, Japan

    Ryoma Ito, Yukako Komaki & Yuko Ibuki

Authors
  1. Ryoma Ito
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Yukako Komaki
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Yuko Ibuki
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Conceptualization: YI; Funding Acquisition: YK, YI, Investigation: RI, YK; Writing - Original Draft Preparation: YK, YI; Writing - Review and Editing: RI, YK, YI.

Corresponding author

Correspondence to Yuko Ibuki.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ito, R., Komaki, Y. & Ibuki, Y. Increased matrix metalloproteinase-1 expression by coexposure to UVA and cigarette sidestream smoke and contribution of histone acetylation. Genes and Environ 47, 2 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s41021-025-00325-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s41021-025-00325-z

Keywords

Genes and Environment

ISSN: 1880-7062

Contact us